Results 1 to 7 of 7

Thread: Tools for automatic reading animation.

  1. #1
    Join Date
    Jan 2020
    Location
    Sweden
    Posts
    3

    Default Tools for automatic reading animation.

    Hi all.

    This is my first post on the forum. So happy to find this forum!

    Im an artist based in Sweden who mainly has been working with videobased installations during the years. Based on projected light Im now staring up a project with laser as the main material.

    As Im new in the field om looking into the different tools of creating content. One of my key functions Im looking for is a way to automatically read a huge amount of letters and transform these individual letters into execution of letter specific assigned animations.

    For example: If I have a text row " ABCBBBCBBABBBBCDDDAAEEE" I would like an animation linked to letter "A" to be executed, followed by animation "B" Then animation "C" then "B" again. "B" again in a continues flow.

    The amount of letters in each full animation flow will vary from just a few up to a few thousand, and the way Im trying to find is this enormous capacity when we comes to the latter letter amount.

    Looking into buying either Beyond of LSX, maybe if I need both, but just trying to get a picture of whats possible before letting go of the cash. If some of you knows things in depth know a solution it would help me soo much.

    Maybe I need to go tough some external reader and send instructions though Midi?

    Well hope you get my questions.

    Thanks so much for any thoughts!

  2. #2
    Join Date
    Jan 2006
    Location
    Charleston, SC
    Posts
    2,147,488,972

    Default

    Quote Originally Posted by Rymdfyr View Post
    Im an artist based in Sweden who mainly has been working with videobased installations during the years. Based on projected light Im now staring up a project with laser as the main material.
    Welcome to the forum! Always happy to see new folks.

    Before we go any further - a standard disclaimer: Laser projectors can cause serious eye injury (including blindness) as well as thermal burns to the skin. They can also damage digital still-image and video cameras, as well as certain types of video projectors (mostly DLP projectors). Any laser operator should be very familiar with the safety concerns and legal requirements surrounding lasers and laser projectors before they purchase, install, or operate any laser equipment.

    Also, the laws governing the use of lasers in public differ greatly depending on which country you are operating in. I honestly don't know what the laws are in Sweden. But most countries require at least some equipment certification, while other countries also require the operator to obtain licensing or other approval before using lasers or laser projectors in public. Before you get too involved with this new project, I urge you to research this topic thoroughly so you understand the legal requirements and safety regulations.

    One of my key functions Im looking for is a way to automatically read a huge amount of letters and transform these individual letters into execution of letter specific assigned animations.
    Pangolin's Beyond software supports a scripting language called Pango-Script that would allow you to program this fairly easily. However, I'm wondering if there isn't an easier way to accomplish your goal.

    Is the letter sequence always going to be the same, or will it change in real time based on some outside trigger? If it's always going to be the same, then what you're describing is a timeline, and that's a feature that nearly every laser show software package supports. If you've ever worked with video editing software, you understand how a timeline works. Pre-choreographed laser shows are edited together in the same way as a video would be.

    Basically you have a linear sequence of frames and animations that play back in a defined order from start to finish. You can add all sorts of effects to the content on the timeline, and you can also add an audio track to the timeline so you can synchronize the show to music. You can work on the timeline in any order you want, but when you're all done the show will always play in the same order from the beginning to the end.

    On the other hand, if the sequence of frames or animations that you want to display will be constantly changing and you need the laser show software to *automatically* respond in real time to changes in the sequencing, then you're back to the Beyond + Pango-script solution I mentioned above.

    Note that there is a third option we haven't discussed, and that's having an operator making the selections in real time. This is how live laser shows are done. The operator listens to the music and selects frames, animations, and effects as needed to make a pleasing show that follows the beat. This live control method is also supported by nearly all laser show software packages.

    The amount of letters in each full animation flow will vary from just a few up to a few thousand, and the way Im trying to find is this enormous capacity when we comes to the latter letter amount.
    The number of animations you have to choose from is limited only by your ability to collect (or create) the content and the amount of hard drive space available on your computer. I've seen workspaces for Beyond that had thousands of cues. And each cue can be a single frame, or a short looping animation, or an abstract pattern, or even an entire show sequence lasting several minutes with multiple scenes. So it's no problem to have hundreds of thousands of frames ready to be selected and displayed at any given time. To automate the frame-selection process from that large library of frames based on a string of letters is a trivial Pango-Script application.

    But I'm curious why you're stuck on using a string of letters to select the frames or animations. That would dramatically limit the number of choices... (upper and lower case plus the numbers 0-9 would give you 62 choices, but even if you used the entire ASCII character set you're only looking at 127 choices) Is there another part of this application (apart from the laser projector) that is driving the need to use letters?

    Looking into buying either Beyond or LSX
    Both are solid choices for laser shows, although I believe Beyond may have an advantage for your application because of Beyond's Pango-Script support. (Beyond is also more expensive, however.)

    just trying to get a picture of whats possible before letting go of the cash
    Smart. Don't buy *anything* until you've done more research. I can't tell you how many people have wasted money because they bought something on a whim, only to learn later that it's not adequate for their needs.

    Maybe I need to go tough some external reader and send instructions though Midi?
    Not sure about LSX, but I know that Beyond supports MIDI in and out, and you can use physical MIDI devices or virtual software MIDI solutions that mimic the hardware but actually talk to other programs.

    Again though, we need more information about exactly what you want to accomplish and why letters in particular are required for the frame or animation selection process. Unless your idea is something very specific to those letters, I suspect there is a much easier way to get the results you're describing.

    Adam

  3. #3
    Join Date
    Jan 2020
    Location
    Sweden
    Posts
    3

    Default

    Hi and thanks for the extended reply and warm welcome!, unfortunately I had some illness and been away from work for a while, so my reply got heavily delayed.

    Welcome to the forum! Always happy to see new folks.

    Before we go any further - a standard disclaimer: Laser projectors can cause serious eye injury (including blindness) as well as thermal burns to the skin. They can also damage digital still-image and video cameras, as well as certain types of video projectors (mostly DLP projectors). Any laser operator should be very familiar with the safety concerns and legal requirements surrounding lasers and laser projectors before they purchase, install, or operate any laser equipment.

    Also, the laws governing the use of lasers in public differ greatly depending on which country you are operating in. I honestly don't know what the laws are in Sweden. But most countries require at least some equipment certification, while other countries also require the operator to obtain licensing or other approval before using lasers or laser projectors in public. Before you get too involved with this new project, I urge you to research this topic thoroughly so you understand the legal requirements and safety regulations.
    Im aware of the safety details and regulations for the location of realization, thats more or less what I started with and its probably the field within the laserdomain I have my most extended knowledge at this point. As Ive been working with public art for a while I know that for dreams to become reality in a larger scale, you need to be aware and make sure an audience can behave in the most unexpected ways. Ill do the installations later at high towers, unreachable and it will be impossible that the beams hit an eye, if one dont show up in a helicopter, violating the closed air-space. Ill use a drone for documentations, and maybe thats my larger concern, that the camera will be hit if the operator gets to wild getting nice perspectives.


    Pangolin's Beyond software supports a scripting language called Pango-Script that would allow you to program this fairly easily. However, I'm wondering if there isn't an easier way to accomplish your goal.
    Yes, Ive been research LSX and Beyond to find out what would suite the needs and both comes with pros and cons, hopefully Ill be able to try a full version of Beyond soon even though the demo offers quite a good understanding. Im not at the final decision how my visuals will take form and based on what foundation, but it will probably include both text, pictures and 3D-renderings. Beyond got a lot of good study material as a part of their products which is great for a novice without a proper network around.

    Is the letter sequence always going to be the same, or will it change in real time based on some outside trigger? If it's always going to be the same, then what you're describing is a timeline, and that's a feature that nearly every laser show software package supports. If you've ever worked with video editing software, you understand how a timeline works. Pre-choreographed laser shows are edited together in the same way as a video would be.

    Basically you have a linear sequence of frames and animations that play back in a defined order from start to finish. You can add all sorts of effects to the content on the timeline, and you can also add an audio track to the timeline so you can synchronize the show to music. You can work on the timeline in any order you want, but when you're all done the show will always play in the same order from the beginning to the end.
    One key aspect that was the initial trigger for this post is an aim to be able to directly use raw DNA-data based on raw data from a textfile: Example:

    Random DNA Sequence results
    >random sequence 1 consisting of 100 bases.
    cggttatccgatgagcccttgaagccgttatgtatgaaaagagggttaag tcctgatgtg
    cgcatagttggctctatcgtatgacataggcctgtcgtca

    So the trigger information consists of the letter CGTA in a huge amount, so I want to generate a automatic srcipt for reading a text document, triggering 4 different animations in a software. Seams like it can be done quite easily with a pipe in Linux, if you know your way around

    On the other hand, if the sequence of frames or animations that you want to display will be constantly changing and you need the laser show software to *automatically* respond in real time to changes in the sequencing, then you're back to the Beyond + Pango-script solution I mentioned above.

    Note that there is a third option we haven't discussed, and that's having an operator making the selections in real time. This is how live laser shows are done. The operator listens to the music and selects frames, animations, and effects as needed to make a pleasing show that follows the beat. This live control method is also supported by nearly all laser show software packages.
    So the real time reactions will not be necessary in this project, everything can be pre-programmed.

    The number of animations you have to choose from is limited only by your ability to collect (or create) the content and the amount of hard drive space available on your computer. I've seen workspaces for Beyond that had thousands of cues. And each cue can be a single frame, or a short looping animation, or an abstract pattern, or even an entire show sequence lasting several minutes with multiple scenes. So it's no problem to have hundreds of thousands of frames ready to be selected and displayed at any given time. To automate the frame-selection process from that large library of frames based on a string of letters is a trivial Pango-Script application.

    But I'm curious why you're stuck on using a string of letters to select the frames or animations. That would dramatically limit the number of choices... (upper and lower case plus the numbers 0-9 would give you 62 choices, but even if you used the entire ASCII character set you're only looking at 127 choices) Is there another part of this application (apart from the laser projector) that is driving the need to use letters?
    As described before its the DNA data that makes me stuck at the letters, and were talking such a mounts that it will be impossible to do it by hand since I would like to under a couple of thousand letters for this idea. DNA to laser has probably been done before and if anyone reading this has links or tips where I can find examples it would be wonderful!

    Both are solid choices for laser shows, although I believe Beyond may have an advantage for your application because of Beyond's Pango-Script support. (Beyond is also more expensive, however.)
    Yes, Beyond seams like a good option, and their custumer support seams quick and polite as well. By Pango-script I might be able to pass the Linux learning course as well, even though its tempting to understand bash etc.

    Smart. Don't buy *anything* until you've done more research. I can't tell you how many people have wasted money because they bought something on a whim, only to learn later that it's not adequate for their needs.
    Yes, still waiting and mainly testing demos. One key aspect later on is that the show itself must be able to be played back directly from SD-card at a set time and date, or it would be really beneficial anyhow. But I guess both Pangolin FB4 (Beyond) and Ether dream 2 (LSX) would be able to do this? Is it possible to synd two different freestanding units?

    Not sure about LSX, but I know that Beyond supports MIDI in and out, and you can use physical MIDI devices or virtual software MIDI solutions that mimic the hardware but actually talk to other programs.

    Again though, we need more information about exactly what you want to accomplish and why letters in particular are required for the frame or animation selection process. Unless your idea is something very specific to those letters, I suspect there is a much easier way to get the results you're describing.
    Yes, this is what I heard and that it might would be an option to use the pipe function in linux to generete a midifile based on the letter in the DNA-sting and then use the Minifile to trigger LSX or Beyond. Might be a track.

    Adam[/QUOTE]

    Thanks for the reply!!

  4. #4
    Join Date
    Nov 2008
    Location
    Cleveland Ohio
    Posts
    2,288

    Default

    I did this exact project a number of years back. I first converted the dna string to 1 2 3 4. Skipping thymidine. Then I feed the sequence via midi. Now I was changing colors so my logic was a simple and gate setup. In your case I think you just feed the midi to pangolin as a cc and read the cue.

  5. #5
    Join Date
    Jan 2020
    Location
    Sweden
    Posts
    3

    Default

    Quote Originally Posted by kecked View Post
    I did this exact project a number of years back. I first converted the dna string to 1 2 3 4. Skipping thymidine. Then I feed the sequence via midi. Now I was changing colors so my logic was a simple and gate setup. In your case I think you just feed the midi to pangolin as a cc and read the cue.
    Thats great! what kind of application and how did you feed the data string to the midi converter? Did you send it realtime or did you convert the data to midi as a first step, then midi to pantolin second step?

    Do you have any documentation of your results that I can take part of?

    Thanks!

  6. #6
    Join Date
    Jan 2006
    Location
    Charleston, SC
    Posts
    2,147,488,972

    Default

    I'm still not clear as to whether the end product is supposed to be a static, unchanging show or whether it needs to respond in real time to changing input.

    If the sequence of letters (no matter how long) isn't going to change, then the whole sequence can be pre-programmed in advance and then you just hit play. Any laser software can do this.

    If you wanted to automate the programming part by having the software read a text file and convert the letters to cues, that would be a job for Beyond and Pangoscript. Once the script finished running you would save the generated show and then you could play it back at any time.

    However, once you've written the script to convert the letters in a text file to a series of cues on a timeline, it's only a small jump from that point to a real-time version that accepts input and triggers the cues on-the-fly. (Like Marc's MIDI example above.) I'm just not sure if this real-time ability is needed / wanted or not.

    Adam

  7. #7
    Join Date
    Nov 2008
    Location
    Cleveland Ohio
    Posts
    2,288

    Default

    Quote Originally Posted by Rymdfyr View Post
    Thats great! what kind of application and how did you feed the data string to the midi converter? Did you send it realtime or did you convert the data to midi as a first step, then midi to pantolin second step?

    Do you have any documentation of your results that I can take part of?

    Thanks!
    I converted the letters to 1234 and then chose 4 notes from a scale like a wind chime. I then added a random note length. That was sent as midi. it sounded very much like a wind chime. If I did it again I might use a wind chime and a little actuator to hit the chime. Load my own DNA sequence. Interesting product. Your own dna wind chime. Do dna test and chime. Send an sd card with data with chime.

    https://spiralsofjoy.com/product/sou...d-chime-large/

    I looked and that was 15 years ago so I have no idea where the project materials went sorry
    Last edited by kecked; 03-28-2020 at 18:41.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •